The isolation and characterization of diarrheagenic Escherichia coli strains from sources of meat in Bannu, KP, Pakistan
Original Article

The isolation and characterization of diarrheagenic Escherichia coli strains from sources of meat in Bannu, KP, Pakistan

Mir Sadiq Shah1, Fahim Ullah Khan1, Muneeba Wali2, Autif Hussain Mangi3, Zahid Rehman1, Zakim Ullah1, Junaid Ali1, Arif Ullah1, Muhammad Hashim1, Abdullah Khan1, Ahmad Zeb Khan1, Muhammad Sufyan Khan1, Shama Sehar4, Faryal Muzzafar1, Surayia Shahab Rani5

1Department of Zoology, University of Science and Technology Bannu, Bannu, KP, Pakistan; 2Department of Microbiology, CECOS University, Peshawar, KP, Pakistan; 3Institute of Biochemistry, University of Sindh, Jamshoro, Sindh, Pakistan; 4Department of Biology, College of Science, University of Bahrain, Sakhir, Kingdom of Bahrain; 5Department of Pharmacy, University of Sargodha, Sargodha, Pakistan

Contributions: (I) Conception and design: MS Shah, M Wali, S Sehar; (II) Administrative support: None; (III) Provision of study materials or patients: MS Shah; (IV) Collection and assembly of data: MS Shah; (V) Data analysis and interpretation: FU Khan; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

Correspondence to: Dr. Fahim Ullah Khan, PhD. Department of Zoology, University of Science and Technology Bannu, XJ9J+F4W, D I Khan Rd, Bannu, Khyber Pakhtunkhwa, Pakistan. Email: fahimjani85@gmail.com.

Background: Microbial contamination of meat sources including undercooked meat products is regarded as an emerging means of food-borne disease outbreaks. Diarrheagenic Escherichia coli (DEC) is an important agent of infectious diarrhea and is constantly evolving; hence its periodic monitoring is always required. Escherichia coli (E. coli) pathotypes including food-borne pathogens such as Shiga toxin-producing E. coli (STEC) and enteropathogenic E. coli (EPEC) cause hemolytic uremic syndrome and fatal infant diarrhea. Herein, we focused on microbial contamination, especially E. coli pathotypes of retailed meat sources in the Bannu district of Khyber Pakhtunkhwa, Pakistan.

Methods: Two hundred carcass samples from perineal area, flank, brisket, and neck region were collected from butcheries located in B.D Kp Pakistan using sterile bags. These different samples were inoculation on differential media for biochemical characterization and multiplex PCR assays.

Results: We found that the percentage of contamination in beef by E. coli serotype O157:H7 was in beef meat 20.9%, chicken meat 0.00, and goat meat 34%. Furthermore, for confirmation of STEC, the stx1 and stx2 genes were amplified using the isolated E. coli strains. Prevalence of 21.5% and 5.9% were recorded for Shiga toxin-producing E. coli strains from sheep and goats respectively. The proportion of EPEC isolated from goat and chicken were 75% and 62.5% for strains isolated in samples. Enterotoxigenic E. coli were positive for heat-labile toxin (LT) genes compared to 37.5% having heat-stable toxin (ST) producing genes. Among ninety-seven percent of E. coli pathotypes showed resistance to tetracycline, while the 91% showed resistance to ciprofloxacin.

Conclusions: To reduce food-borne pathogen contamination, novel, practical, and efficient food safety control and surveillance technologies for multi-drug resistant food-borne pathogens are required.

Keywords: Escherichia coli (E. coli); heat-labile toxin (LT); heat-stable toxin (ST)

Received: 15 February 2024; Accepted: 10 July 2024; Published online: 02 September 2024.

doi: 10.21037/jxym-24-8

Highlight box

Key findings

• Shiga toxin (Stx) producing Escherichia coli (E. coli) having both stx1 and stx2 genes were detected.

• Enterotoxigenic E. coli was positive for heat-labile toxin (LT) genes.

What is known and what is new?

• Meat samples are contaminated with a variety of pathogenic E. coli pathotypes.

• Diarrheagenic E. coli is generally responsible for onset of mild to hemorrhagic colitis.

• Shiga toxin producing E. coli with stx1 and stx2 are detected among the studies samples.

• Among ninety-seven percent of E. coli pathotypes showed resistance to tetracycline.

• 91% E. coli strains showed resistance to ciprofloxacin.

• Presence of pathogenic E. coli strains showed the substandard hygienic conditions and under cooked food consumption.

What is the implication, and what should change now?

• Maintenance of hygienic conditions both at abattoirs and butcher’s shop.

• Proper food cooking is recommended to reduce pathogens load.

• Use of antibiotics should be minimized in animal feed.

Introduction

Each year, there are around 600 million food-borne infection cases worldwide, with a death rate of over 500,000 (1). Ingestion of contaminated food or water with Enterobacteriaceae such as Salmonella sp, Escherichia coli (E. coli), Proteus, and Klebsiella species causes food or waterborne microbial invasions (2). E. coli is a typical element of the body’s flora that resides in the guts of humans and other animals (3). On the other hand, certain pathogenic E. coli strains have the ability to infect the gut lining and cause serious infections such as bloody diarrhea and hemolytic uremic syndrome (HUS) (4). Based on essential virulence determinants that define pathogenicity, E. coli has been categorized into distinct pathovars such as enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC) and enterohemorrhagic E. coli (EHEC), entero aggregative E. coli (EAEC), entero invasive E. coli (EIEC) and diffusely adherent E. coli (DAEC) (2,5,6). Due to the switch from the normal net absorptive condition of water and electrolyte absorption to secretion, infection with pathogenic E. coli frequently causes severe diarrhea. Infection with diarrhea affects more than 1.7 billion individuals annually. Meat products, chicken salad, ground beef, and raw beef dinners are all potential sources of E. coli contamination (7-10). More particular, by invading their large intestine and rectum, 10–80% of cattle act as natural reservoirs of pathogenic E. coli and remain asymptomatic (11).

Hemorrhagic colitis (HC) and HUS can be triggered by E. coli (12). E. coli O157:H7, a pathogenic strain, has been isolated from cattle, their carcasses, hides, and feces (13). Undercooked ground beef, fresh goods, unpasteurized juices, salami, cheese, and raw (unpasteurized) milk are among the foods linked to Shiga toxin-producing E. coli (STEC) outbreaks (14). O157:H7 is the most commonly associated STEC sero-group with food-borne epidemics in North America, Japan, and portions of Europe with symptoms ranging from moderate diarrhea to life-threatening hemolytic-uremic syndrome (15). Food-borne pathogens like Shiga toxin-producing E. coli (STEC) can cause severe illnesses like hemolytic-uremic syndrome (HUS). Shiga toxins (Stxs) are produced when STEC colonizes the lower intestine. STEC includes a wide range of E. coli strains that can be identified by having either the stx1 or stx2 gene, or even both. Stxs appear to translocate across intestinal epithelia and have an impact on sensitive endothelial cell beds in various locations. The majority of pathogenic STEC strains have the locus for enterocyte effacement (LEE) pathogenicity Island, a sizable 93-kb plasmid, and genes that allow E. coli to attach to and efface epithelial cells (16-18). When this protein interacts with its translocated receptor Tir (which stands for translocated intimin receptor), a protein encoded upstream of the eae gene on the LEE, it promotes direct attachment to target eukaryotic cells (19). Stx’s major role is to cleave the 28S rRNA, which causes tRNA-60S rRNA binding to be inhibited and peptide elongation to be disrupted during protein synthesis (20). The primary cause of HUS and HC in humans is a gastrointestinal tract caused by E. coli O157:H7 due to the Stx absorption through the stomach and subsequent glomerular vascular injury (21).

Atypical EPEC strains lack the EPEC adherence factor (EAF) plasmid, which encodes (bundle-forming pilus), whereas typical EPEC strains develop the attaching and effacing (A/E) lesions and have the EAF plasmid (22). ETEC has two major virulence factors: heat-stable toxin (ST) and/or heat-labile toxin (LT) enterotoxins, as well as numerous antigenic fimbriae known as colonization factors (CFs) (23).

Antibiotic resistance is a global public health issue, and emerging data suggests that both human and animal antimicrobial use are some of its contributing factors (24). In addition, antimicrobial resistance leaves room for just fewer drug choices hence increases the risk of treatment failure, and poor clinical consequences (25,26). We therefore, investigated the prevalence of diarrheagenic E. coli (DEC) pathotypes along their biochemical and molecular characterization for the detection of pathotypes specific genes e.g., stx1, stx2, eae, hly using multiplex PCR among retailed meat sources. We present this article in accordance with the MDAR reporting checklist (available at https://jxym.amegroups.com/article/view/10.21037/jxym-24-8/rc).

Methods

Samples collection

Almost 200 meat samples were collected in sterile bags from different butcheries and retail outlets in district Bannu (Southern district of Khyber Pakhtunkhwa, Pakistan). These meat samples were comprised of rump (perineal area), flank, and brisket and neck region. These samples were sterilized with 70% alcohol and both excision and swabs were obtained.

Isolation and characterization of DEC pathogens

The meat samples were collected in clean sterile bags and preserved in ice box and brought to Laboratory at the Department of Zoology, University of Science and Technology, Bannu, KP, Pakistan, where identification and characterization were carried out. The excision samples containing 20 mL peptone water along with excised tissue were placed in stomacher bag having 80 mL peptone water and homogenized for 2 minutes. Each sample homogenate (containing either excision or swabbing) was further diluted with peptone water (1:10). About 1 mL aliquots of homogenate sample was inoculated on Eosin Methylene Blue agar (EMB, Thermo Scientific™ Oxoid™, UK) medium and incubated for 24 hours.

Species specific identification was carried out by inoculating E. coli colonies on Sorbitol Mac Conkey agar (SMAC; Oxoid) and cefixime-tellurite-sorbitol Mac Conkey agar (CT-SMAC; Oxoid) (15). Similarly, Latex agglutination (E. coli O157 Dryspot test kit, Oxoid) was used to test suspected colonies (clear to smoky grey) for the O157 antigen.

Characterization of DEC pathotypes

The Qiagen Mini Amp kit (Germany) was used to extract DNA. The bacteria were lysed for 15 minutes at 100 ℃ using a Dri-block DB.2A (Techne, SA) after a loop of overnight grown DEC was suspended in 200 mL of sterile Milli-Q PCR grade water (Merck, SA). Using a Mini Spin micro-centrifuge, the cell debris was removed by centrifugation at 20,000 rpm for 2 minutes. CASVAB, University of Baluchistan, Quetta, provided DNA templates as negative and positive controls, as well as cultures of locally isolated E. coli O157:H7 positive for stx1 and stx2 toxins, ETEC, and EPEC.

Multiplex PCR assay

A volume of 22 µL was utilized, which contained 5 µL (20 pmol) of template DNA, 5 µL of (10X) PCR buffer, 5 µL of a Q solution (10X buffer), 0.25 µL of (250 U) Taq-polymerase per ml (Sigma, USA), 0.75 µL (20 mM) of each primer (Sigma), and 7 µL of PCR water; 96 ℃ for 5 min, 94 ℃ for 30 sec, 57 ℃ for 30 sec, and 72 ℃ for 1 min were the cycle steps that were adjusted using a Gene Amp PCR system 9700 (AB Applied Bio System, USA), with a final 5-min extension at 72 ℃.

Antimicrobial susceptibility testing

Using a Kirby-Bauer disk diffusion assay CLSI (2002), the antimicrobial sensitivity of Dec pathotypes was evaluated. The following 8 antibiotics were used: amoxicillin-clavulanic acid (AMC), 20/10 µg; cefotaxime (CTX), 30 µg; cefuroxime (CRO), 30 µg; nalidixic acid (NAL), 30 µg; ciprofloxacin (CIP), 5 µg; streptomycin (STR), 10 µg; tetracycline (TET), 30 µg; and sulfamethoxazole-trimethoprim (SXT), 23.75/1.25 µg. The disks were purchased from Oxoid (England) and the zone-size interpretive chart that was provided by the manufacturer was used to record the results.

Statistical analysis

Processing and analysis of the data were carried out with GraphPad Prism Ver. 8.0 (GraphPad Software). The method of obtained data is described in the result part.

Results

The prevalence of DEC in a variety of meat sources

Initially, we examined the prevalence of E. coli in the different mentioned sources of meat.

We observed that the contamination prevalence of E. coli was about 58% (29/50) of the retailed beef meat, where 20.9% (6/29) were identified as serotype O157:H7. Next, we examined the chicken meat samples and found the contamination prevalence was 16% (8/50) E. coli with no serotype O157:H7. Serotype O157:H7 21.5% (3/14) was directly detected in sheep samples. Comparably, out of 50 goat samples, 34% (17/50) exhibited E. coli contamination, with only one (5.9%) among 17 of the samples having the confirmed serotype O157:H7 (Figure 1).

Figure 1 Prevalence of Escherichia coli (E. coli) O157:H7 among isolated E. coli strains. Image (A) represents total E. coli contamination among beef, chicken, goat and sheep meat samples. Image (B) represents the positive sample of E. coli Serotype O157:H7contamination among beef, chicken, goat and sheep meat samples.

Detection and comparison of LT and ST producing genes among ETEC (LT) strains

Furthermore, we noticed that the 75% ETEC (LT) strains were positive for LT compared to 25% of ETEC (ST) in chicken meat samples. Similarly, higher detection rate (62.5%) of ETEC (LT) was observed in beef meat samples compared to (37.5%) ETEC (ST). ETEC (LT) was also predominantly (80%) detected in mutton samples compared to (20%) of ETEC (ST), whereas, 100% ETEC detected in goat meat samples were observed as ETEC (LT).

During the present study an EPEC was predominantly detected in poultry meat samples (100%), (75%) in beef meat samples and (100%) in goat meat samples compared to typical EPEC. Interestingly no STEC was detected in chicken meat samples. Higher prevalence of STEC was observed in beef and mutton meat sources (Figure 2).

Figure 2 Prevalence of LT and ST producing genes among ETEC isolated from respective meat samples. LT, heat-labile toxin; ST, heat-stable toxin; ETEC, enterotoxigenic Escherichia coli.

Antibiotic susceptibility test

During the present study, 97% antibiotic resistance was observed against TET. Pathogroups wise resistance was as 100% in ETEC, 92% by EPEC, and 100% by STEC (shown in Table 1). Similarly, 91% resistance was observed against (CIP) of aminoglycoside, where pathogroups specific resistance is as 94% in ETEC, 83% in EPEC, and 100% in EHEC. Low level (52%) of antibiotic resistance was observed against (AMC) of β lactams, where individual pathogroups specific resistance was as follows, 59% in ETEC, 33% in EPEC, and 75% in EHEC (shown in Table 2).

Table 1

List of primers used in this study

Shiga toxin primer 5'→3' primer forward (primer name) 5'→3' primer reverse (primer name) References
stx1 ATAAATCGCCATTCGTTGACTAC AGAACGCCCACTGAGATCATC (27)
stx2 GGCACTGTCTGAAACTGCTCC TCGCCAGTTATCTGACATTCTG (27)
stx2c CTGAACAGAAAGTCACAGTYTTTA GGCCACTTTTACTGTGAATGTATC (28)
stx2c-b AGTACTCTTTTCCGGCCACT GCGGTTTTATTTGCATTAGT (c-a) (29)
stx2-b TCCCGTCAACCTTCACTGTA (b) GCGGTTTTATTTGCATTAGC (a) (29)

Table 2

Antibiotic resistance of the E. coli pathogroups against routinely prescribed antibiotics

Class and antimicrobials Phenotype and % resistant
Total (n=33) ETEC (n=17) EPEC (n=12) EHEC (n=4)
Aminoglycoside
   Streptomycin 24/33 (73%) 13/17 (76%) 8/12 (67%) 3/4 (75%)
Quinolones and fluoroquinolones
   Nalidixic acid 22/33 (67%) 11/17 (65%) 7/12 (58%) 4/4 (100%)
   Ciprofloxacin 30/33 (91%) 16/17 (94%) 10/12 (83%) 4/4 (100%)
Sulfonamides
   Sulfamethoxazole-trimethoprim 19/33 (57%) 8/17 (47%) 6/12 (50%) 4/4 (100%)
Tetracycline 32/33 (97%) 17/17 (100%) 11/12 (92%) 4/4 (100%)
β lactams
   Amoxicillin-clavulanic acid 17/33 (52%) 10/17 (59%) 4/12 (33%) 3/4 (75%)
Cephalosporin
   Cefuroxime 21/33 (64%) 10/17 (59%) 8/12 (67%) 3/4 (75%)
   Cefotaxime 23/33 (70%) 14/17 (82%) 6/12 (50%) 3/4 (75%)

ETEC, enterotoxigenic Escherichia coli; EPEC, enteropathogenic Escherichia coli; EHEC, enterohemorrhagic Escherichia coli.

Discussion

Diarrheal infection due to E. coli pathotypes is rising public health concern in the developing countries. The consumption of contaminated food and water is thought to be the main source of the spread of DEC pathotypes. In the current study, 29 out of 50 beef samples (58%) were found to be contaminated with E. coli pathotypes, and 20.7% (6/29) of those were serotype O157:H7. Comparatively, high prevalence rates of serotype O157:H7 in beef samples of 74.5% in South Africa and 36% in Malaysia have been reported (30).

According to the findings of our study, the higher prevalence of DEPs in Pakistan’s slaughterhouses and processing facilities is an indication that unhygienic conditions are common. The previously published reported document that the presence of STEC (2.4%) isolates along with 15.56% EPEC in chicken meat samples (31). In the current study, E. coli was found in 16% (8/50) of the chicken meat samples, but none of them were E. coli O157:H7 serotypes.

Our study enlisted that E. coli pathotypes were found in 34% (17/50) of the goat meat samples and 5.9% (1/17) of the isolates were serotype O157:H7. According to reports, there is a high prevalence of STEC in goat meat in Germany (56.1%), Spain (47.7%), Bangladesh (10.0%), and Nigeria (7.5%), compared to a study in Iran that found an 11.6% prevalence (19/159) in sheep meat samples and a 2.5% prevalence rate of E. coli O157:H7 in Ethiopia (32-36). Similarly, 2.0% of E. coli O157:H7 was reported in sheep and goat meat samples; (0.77–7.3%) is in Italy, 4.0% in Egyptian, 1.5% in USA and 0.5% in Australia (37-40).

ETEC with LT producing genes were detected more compared to the ETEC with ST producing genes. During the present study, 62.5% of ETEC containing (LT) were isolated from beef meat samples, 80% in mutton samples and 100% in goat meat samples compared to ETEC (ST). A study from Korea reported 14% prevalence of pathogenic E. coli in fresh meat collected in several provinces, with ETEC constituting 43.6% of ETEC (LT) (41). During the present study, prevalence of atypical EPEC (aEPEC) was observed as 100% in poultry, 75% beef, 50% sheep and 100% in goat meat samples compared to tEPEC. The presence of more atypical EPEC than typical EPEC in food samples is consistent with previous published report (42-44).

The overuse of antibiotics for disease prevention and rapid animal growth/dairy product production, as well as their self-prescription and misuse, are responsible for the emergence of antibiotic resistance because they provide the resistant microbial phenotype a chance to adapt. In the current examination, against TET, the greatest resistance (97%) was noted. These findings are consistent with earlier reports, which indicated that 91% of E. coli in Pakistan has TET resistance (45). Although 97% of the isolates exhibited TET resistance, it is imperative to check isolates for the presence of four distinct TET resistance genes (tetA to tetD). E. coli pathotypes i.e., EPEC, ETEC (100%), EIEC, and EAEC are 100% resistant to available drugs to patients in Kenya, so that there are no appropriate treatments exist (46). Our studies found that pathogroups wise resistance was as 100% in ETEC, 92% by EPEC, 100% by STEC and 91% resistance was observed against (CIP) of aminoglycoside. Moreover, pathogroups specific resistance is as 94% in ETEC, 83% in EPEC, and 100% in STEC. Furthermore, we noticed that the low level (52%) of antibiotic resistance was observed against (AMC) of β lactams, where individual pathogroups specific resistance was as follows, 59% in ETEC, 33% in EPEC, and 75% in STEC (shown in Table 2). Most of the ETEC, EAEC and EPEC strains (25–90%) were isolated from the respective meat samples and showed resistance to Sulfamethoxazole-trimethoprim, tetracyclin, ciprofloxacin and cefotoxime. Additionally, 95% of ESBL producers and 56% of non-producers showed CIP resistance, which is high compared to another report from Pakistan (47). This resistance may be a result of fluoroquinolones being the preferred treatment for UTI infections in Pakistan. According to our study, cephalosporin resistance is also increasing in Pakistan, where resistance to cefuroxime was found to be 54% and 52%, respectively.

Conclusions

Our study suggests that contamination of beef and goat, sheep with E. coli pathotype and serotype O157:H7 causes serious concerns. The prevalence of aEPEC was observed in poultry, beef, sheep, and goat meat compared to tEPEC. Excessive use of antibiotics in both poultry and veterinary industries causes a serious threat to the rise of antimicrobial resistance.

Acknowledgments

The article’s authors are highly grateful for the valuable assistance of the CASVAB, the University of Baluchistan, and Quetta.

Funding: None.

Footnote

Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://jxym.amegroups.com/article/view/10.21037/jxym-24-8/rc

Data Sharing Statement: Available at https://jxym.amegroups.com/article/view/10.21037/jxym-24-8/dss

Peer Review File: Available at https://jxym.amegroups.com/article/view/10.21037/jxym-24-8/prf

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://jxym.amegroups.com/article/view/10.21037/jxym-24-8/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. IRB approval was not required as there is no human experiment involved.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.

References

  1. Havelaar AH, Kirk MD, Torgerson PR, et al. World Health Organization Global Estimates and Regional Comparisons of the Burden of Foodborne Disease in 2010. PLoS Med 2015;12:e1001923. [Crossref] [PubMed]
  2. Zhao C, Ge B, De Villena J, et al. Prevalence of Campylobacter spp., Escherichia coli, and Salmonella serovars in retail chicken, turkey, pork, and beef from the Greater Washington, D.C., area. Appl Environ Microbiol 2001;67:5431-6. [Crossref] [PubMed]
  3. Croxen MA, Finlay BB. Molecular mechanisms of Escherichia coli pathogenicity. Nat Rev Microbiol 2010;8:26-38. [Crossref] [PubMed]
  4. Croxen MA, Law RJ, Scholz R, et al. Recent advances in understanding enteric pathogenic Escherichia coli. Clin Microbiol Rev 2013;26:822-80. [Crossref] [PubMed]
  5. Rappelli P, Folgosa E, Solinas ML, et al. Pathogenic enteric Escherichia coli in children with and without diarrhea in Maputo, Mozambique. FEMS Immunol Med Microbiol 2005;43:67-72. [Crossref] [PubMed]
  6. McAuley CM, McMillan K, Moore SC, et al. Prevalence and characterization of foodborne pathogens from Australian dairy farm environments. J Dairy Sci 2014;97:7402-12. [Crossref] [PubMed]
  7. Gutiérrez Garitano I, Naranjo M, Forier A, et al. Shigellosis outbreak linked to canteen-food consumption in a public institution: a matched case-control study. Epidemiol Infect 2011;139:1956-64. [Crossref] [PubMed]
  8. Hao R, Qiu S, Wang Y, et al. Quinolone-resistant Escherichia coli O127a:K63 serotype with an extended-spectrum-beta-lactamase phenotype from a food poisoning outbreak in China. J Clin Microbiol 2012;50:2450-1. [Crossref] [PubMed]
  9. Nandy S, Dutta S, Ghosh S, et al. Foodborne-associated Shigella sonnei, India, 2009 and 2010. Emerg Infect Dis 2011;17:2072-4. [Crossref] [PubMed]
  10. Park JH, Oh SS, Oh KH, et al. Diarrheal outbreak caused by atypical enteropathogenic Escherichia coli O157:H45 in South Korea. Foodborne Pathog Dis 2014;11:775-81. [Crossref] [PubMed]
  11. Hussein HS, Sakuma T. Prevalence of shiga toxin-producing Escherichia coli in dairy cattle and their products. J Dairy Sci 2005;88:450-65. [Crossref] [PubMed]
  12. Moxley RA. Escherichia coli 0157:H7: an update on intestinal colonization and virulence mechanisms. Anim Health Res Rev 2004;5:15-33. [Crossref] [PubMed]
  13. Brichta-Harhay DM, Arthur TM, Bosilevac JM, et al. Enumeration of Salmonella and Escherichia coli O157:H7 in ground beef, cattle carcass, hide and faecal samples using direct plating methods. J Appl Microbiol 2007;103:1657-68. [Crossref] [PubMed]
  14. Food U. The Bad Bug Book: Food-borne pathogenic microorganisms and natural toxins handbook. Available online: https://wayback.archive-it.org/7993/20170405001300/https://www.fda.gov/downloads/Food/FoodborneIllnessContaminants/UCM297627.pdf
  15. Farrokh C, Jordan K, Auvray F, et al. Review of Shiga-toxin-producing Escherichia coli (STEC) and their significance in dairy production. Int J Food Microbiol 2013;162:190-212. [Crossref] [PubMed]
  16. Chen C, Lewis CR, Goswami K, et al. Identification and characterization of spontaneous deletions within the Sp11-Sp12 prophage region of Escherichia coli O157:H7 Sakai. Appl Environ Microbiol 2013;79:1934-41. [Crossref] [PubMed]
  17. Karch H, Tarr PI, Bielaszewska M. Enterohaemorrhagic Escherichia coli in human medicine. Int J Med Microbiol 2005;295:405-18. [Crossref] [PubMed]
  18. Hurley BP, Thorpe CM, Acheson DW. Shiga toxin translocation across intestinal epithelial cells is enhanced by neutrophil transmigration. Infect Immun 2001;69:6148-55. [Crossref] [PubMed]
  19. Torres AG, Zhou X, Kaper JB. Adherence of diarrheagenic Escherichia coli strains to epithelial cells. Infect Immun 2005;73:18-29. [Crossref] [PubMed]
  20. Hofmann SL. Southwestern Internal Medicine Conference: Shiga-like toxins in hemolytic-uremic syndrome and thrombotic thrombocytopenic purpura. Am J Med Sci 1993;306:398-406. [Crossref] [PubMed]
  21. Park D, Stanton E, Ciezki K, et al. Evolution of the Stx2-encoding prophage in persistent bovine Escherichia coli O157:H7 strains. Appl Environ Microbiol 2013;79:1563-72. [Crossref] [PubMed]
  22. Stone KD, Zhang HZ, Carlson LK, et al. A cluster of fourteen genes from enteropathogenic Escherichia coli is sufficient for the biogenesis of a type IV pilus. Mol Microbiol 1996;20:325-37. [Crossref] [PubMed]
  23. Isidean SD, Riddle MS, Savarino SJ, et al. A systematic review of ETEC epidemiology focusing on colonization factor and toxin expression. Vaccine 2011;29:6167-78. [Crossref] [PubMed]
  24. Guardabassi L, Jensen LB, Kruse H. Guide to antimicrobial use in animals. Wiley Online Library; 2008.
  25. da Costa PM, Loureiro L, Matos AJ. Transfer of multidrug-resistant bacteria between intermingled ecological niches: the interface between humans, animals and the environment. Int J Environ Res Public Health 2013;10:278-94. [Crossref] [PubMed]
  26. Johnson JR, Kuskowski MA, Smith K, et al. Antimicrobial-resistant and extraintestinal pathogenic Escherichia coli in retail foods. J Infect Dis 2005;191:1040-9. [Crossref] [PubMed]
  27. Paton AW, Paton JC. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J Clin Microbiol 1998;36:598-602. [Crossref] [PubMed]
  28. Besser TE, Shaikh N, Holt NJ, et al. Greater diversity of Shiga toxin-encoding bacteriophage insertion sites among Escherichia coli O157:H7 isolates from cattle than in those from humans. Appl Environ Microbiol 2007;73:671-9. [Crossref] [PubMed]
  29. Wang G, Clark CG, Rodgers FG. Detection in Escherichia coli of the genes encoding the major virulence factors, the genes defining the O157:H7 serotype, and components of the type 2 Shiga toxin family by multiplex PCR. J Clin Microbiol 2002;40:3613-9. [Crossref] [PubMed]
  30. Radu S, Abdul Mutalib S, Rusul G, et al. Detection of Escherichia coli O157:H7 in the beef marketed in Malaysia. Appl Environ Microbiol 1998;64:1153-6. [Crossref] [PubMed]
  31. Farooq S, Hussain I, Mir MA, et al. Isolation of atypical enteropathogenic Escherichia coli and Shiga toxin 1 and 2f-producing Escherichia coli from avian species in India. Lett Appl Microbiol 2009;48:692-7. [PubMed]
  32. Chinen I, Tanaro JD, Miliwebsky E, et al. Isolation and characterization of Escherichia coli O157:H7 from retail meats in Argentina. J Food Prot 2001;64:1346-51. [Crossref] [PubMed]
  33. Abdul-Raouf UM, Ammar MS, Beuchat LR. Isolation of Escherichia coli O157:H7 from some Egyptian foods. Int J Food Microbiol 1996;29:423-6. [Crossref] [PubMed]
  34. Hiko A, Asrat D, Zewde G. Occurrence of Escherichia coli O157:H7 in retail raw meat products in Ethiopia. J Infect Dev Ctries 2008;2:389-93. [PubMed]
  35. Morabito S, Dell’Omo G, Agrimi U, et al. Detection and characterization of Shiga toxin-producing Escherichia coli in feral pigeons. Vet Microbiol 2001;82:275-83. [Crossref] [PubMed]
  36. Doyle MP, Schoeni JL. Isolation of Escherichia coli O157:H7 from retail fresh meats and poultry. Appl Environ Microbiol 1987;53:2394-6. [Crossref] [PubMed]
  37. Momtaz H, Jamshidi A. Shiga toxin-producing Escherichia coli isolated from chicken meat in Iran: serogroups, virulence factors, and antimicrobial resistance properties. Poult Sci 2013;92:1305-13. [Crossref] [PubMed]
  38. Duffy S, Schaffner DW. Modeling the survival of Escherichia coli O157:H7 in apple cider using probability distribution functions for quantitative risk assessment. J Food Prot 2001;64:599-605. [Crossref] [PubMed]
  39. Duffy G, O’Brien SB, Carney E, et al. Characterisation of E. coli O157 isolates from bovine hide and beef trimming in Irish abattoirs by pulsed field gel electrophoresis. J Microbiol Methods 2005;60:375-82. [Crossref] [PubMed]
  40. Jo MY, Kim JH, Lim JH, et al. Prevalence and characteristics of Escherichia coli O157 from major food animals in Korea. Int J Food Microbiol 2004;95:41-9. [Crossref] [PubMed]
  41. Lee GY, Jang HI, Hwang IG, et al. Prevalence and classification of pathogenic Escherichia coli isolated from fresh beef, poultry, and pork in Korea. Int J Food Microbiol 2009;134:196-200. [Crossref] [PubMed]
  42. Canizalez-Roman A, Gonzalez-Nuñez E, Vidal JE, et al. Prevalence and antibiotic resistance profiles of diarrheagenic Escherichia coli strains isolated from food items in northwestern Mexico. Int J Food Microbiol 2013;164:36-45. [Crossref] [PubMed]
  43. Krause G, Zimmermann S, Beutin L. Investigation of domestic animals and pets as a reservoir for intimin- (eae) gene positive Escherichia coli types. Vet Microbiol 2005;106:87-95. [Crossref] [PubMed]
  44. Hernandes RT, Elias WP, Vieira MA, et al. An overview of atypical enteropathogenic Escherichia coli. FEMS Microbiol Lett 2009;297:137-49. [Crossref] [PubMed]
  45. Alami M, Lüke I, Deitermann S, et al. Differential interactions between a twin-arginine signal peptide and its translocase in Escherichia coli. Mol Cell 2003;12:937-46. [Crossref] [PubMed]
  46. Bii CC, Taguchi H, Ouko TT, et al. Detection of virulence-related genes by multiplex PCR in multidrug-resistant diarrhoeagenic Escherichia coli isolates from Kenya and Japan. Epidemiol Infect 2005;133:627-33. [Crossref] [PubMed]
  47. Alam MJ, Zurek L. Seasonal prevalence of Escherichia coli O157:H7 in beef cattle feces. J Food Prot 2006;69:3018-20. [Crossref] [PubMed]
doi: 10.21037/jxym-24-8
Cite this article as: Shah MS, Khan FU, Wali M, Mangi AH, Rehman Z, Ullah Z, Ali J, Ullah A, Hashim M, Khan A, Khan AZ, Khan MS, Sehar S, Muzzafar F, Rani SS. The isolation and characterization of diarrheagenic Escherichia coli strains from sources of meat in Bannu, KP, Pakistan. J Xiangya Med 2024;9:15.

Article Options

Download Citation

Share